python - Python3 write selected zones in a new file -


i had browse dictionary gene's taxon , everytime encounter taxon, open .fasta file same name , in fasta file had geneid encountered during taxon research. possible because in file made dictionary has "taxon1|geneid1, taxon1|geneid2, taxon2|geneid1,...". , so, when meet specific geneid in specific fasta file, had stock lines under specific geneid able write in new file. fasta file looks like:

>taxon|gene1 actgcatcgctagctagaaatcgcta tacgatcaaacctagcgatcttacga >taxon|gene2 tagctagctagctagaatatcccgat gctagcaatgctcttccggtagctat 

so when meet right geneid in fasta file, lines have copy/stock following 2 lines atgc. did few functions make said, i'm stuck , write part of file datas stocked. here part of code :

def readfastafile(taxonomy, searchgeneid):     fastafile = open(taxonomy + ".fasta", "r")     banco = false     geneidsequence = ""     line in fastafile:         if line[0] == ">":             elements = line.split("|")             taxonomy = elements[0]             geneid = elements[1]             if geneid == searchgeneid:                 banco = true             else:                 banco = false         else:             if banco == true:                 geneidsequence += line     fastafile.close()     return geneidsequence  def getsequencesfromfastasandwritetheminnewfastas(dictio):     groupname in dictio:         taxonandgene = dictio[groupname]         groupfastafile = open(groupname + ".fasta", "w")         taxon in taxonandgene:             geneids = taxonandgene[taxon]             #print("search" + str(geneids) + " in " + taxon + ".fasta")             geneid in geneids:                 readfastafile(taxon, geneid)                 groupfastafile.write()         #here part i'm stuck                 groupfastafile.write("\n")         groupfastafile.close() 

my problem in lasts lines (marked #here comment): don't know write between () write data fasta files new file.

thank answers.

anyway, found solution problem.

i added lines :

tempogeneid   = elements[1] geneid        = tempogeneid[0:-1] 

in function :

def readfastafile(taxonomy, searchgeneid): 

to remove "\n" @ end of geneids , added lines :

for geneid in geneids:     groupfastafile.write(">" + taxon + "|" + geneid + "\n" + readfastafile(taxon, geneid)) 

in function :

def getsequencesfromfastasandwritetheminnewfastas(dictio): 

so works expected. i'm sorry if post took time yo read. have great day.


Comments

Popular posts from this blog

java - BeanIO write annotated class to fixedlength -

Using Java 8 lambdas/transformations to combine and flatten two Maps -

How to connect android app to App engine -